EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr16:85457985-85459432]
Chromosome characteristics of TCF7L2[chr16:85457985-85459432]
Back to top
Enhancers possibly regulated by TCF7L2[chr16:85457985-85459432]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85446773 85473775 enh16869
Bone Marrow (K562) Brain (SK-N-SH) Epithelial (MCF-7) Large Intestine Prostate (RWPE1) Esophagus Ovary Bone (Osteoblast) Lung (A549) Stomach Muscle (A673) Placenta Colon (HCT116) Uterus Pancreas Neural Stem Cells (H9) Thymus Heart
chr16 85458916 85459273 vista23306
VISTA
SNP sites on TCF7L2[chr16:85457985-85459432]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85458083 rs2054702 A G 4622773
chr16 85458089 rs2054703 C T 4622774
chr16 85458140 rs558785401 C G 4622775
chr16 85458204 rs9923263 G A 4622776
chr16 85458264 rs562938617 T C 4622777
chr16 85458292 rs79586467 G A 4622778
chr16 85458331 rs2054704 G A 4622779
chr16 85458353 rs567229725 C G,T 4622780
chr16 85458362 rs536382221 C T 4622781
chr16 85458365 rs2054705 T C 4622782
chr16 85458454 rs149610710 CA C 4622783
chr16 85458518 rs62050373 G A 4622784
chr16 85458672 rs12922224 C A 4622785
chr16 85458694 rs9923701 G A 4622786
chr16 85458698 rs151263825 G A 4622787
chr16 85458814 rs12922645 G A 4622788
chr16 85458877 rs79830727 C G 4622789
chr16 85458883 rs118101533 G T 4622790
chr16 85458906 rs144839284 C CACGGGTGATGTGAGGTGGTG 4622791
chr16 85458913 rs56850784 G A 4622792
chr16 85458927 rs139316112 A G 4622793
chr16 85458929 rs62050374 A G,T 4622794
chr16 85459029 rs150029269 T G 4622795
chr16 85459072 rs117270052 C T 4622796
chr16 85459083 rs556631887 C G 4622797
chr16 85459087 rs12598892 T G 4622798
chr16 85459134 rs2035489 T C 4622799
chr16 85459137 rs114687111 C A,T 4622800
chr16 85459175 rs60784382 C T 4622801
chr16 85459188 rs2035490 G A 4622802
chr16 85459238 rs543119375 A C 4622803
Genes possibly regulated by TCF7L2[chr16:85457985-85459432]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr16:85457985-85459432]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results