Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85446773 85473775 enh16869
chr16 85458916 85459273 vista23306

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85458814 rs12922645 G A 4622788
chr16 85458877 rs79830727 C G 4622789
chr16 85458883 rs118101533 G T 4622790
chr16 85458906 rs144839284 C CACGGGTGATGTGAGGTGGTG 4622791
chr16 85458913 rs56850784 G A 4622792
chr16 85458927 rs139316112 A G 4622793
chr16 85458929 rs62050374 A G,T 4622794
chr16 85459029 rs150029269 T G 4622795
chr16 85459072 rs117270052 C T 4622796
chr16 85459083 rs556631887 C G 4622797
chr16 85459087 rs12598892 T G 4622798
chr16 85459134 rs2035489 T C 4622799
chr16 85459137 rs114687111 C A,T 4622800
chr16 85459175 rs60784382 C T 4622801
chr16 85459188 rs2035490 G A 4622802
chr16 85459238 rs543119375 A C 4622803
chr16 85459544 rs11149744 T G 4622804
chr16 85459554 rs11149745 G A 4622805

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results