EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr16:85467045-85467327]
Chromosome characteristics of ZNF143[chr16:85467045-85467327]
Back to top
Enhancers possibly regulated by ZNF143[chr16:85467045-85467327]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85446773 85473775 enh16869
Bone Marrow (K562) Brain (SK-N-SH) Epithelial (MCF-7) Large Intestine Prostate (RWPE1) Esophagus Ovary Bone (Osteoblast) Lung (A549) Stomach Muscle (A673) Placenta Colon (HCT116) Uterus Pancreas Neural Stem Cells (H9) Thymus Heart
SNP sites on ZNF143[chr16:85467045-85467327]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85467194 rs368744364 CTGGA C 4622976
chr16 85467194 rs373838134 CTGGATGGATGGATGGA C 4622977
chr16 85467194 rs538043583 CTGGA C 4622978
chr16 85467194 rs543797630 C CTGGA 4622979
chr16 85467194 rs568317565 CTGGATGGA C 4622980
chr16 85467194 rs57012969 CTGGATGGATGGATGGATGGA C 4622981
chr16 85467194 rs570757388 CTGGATGGATGGATGGA C 4622982
chr16 85467194 rs71851278 CTGGATGGATGGATGGATGGA C 4622983
chr16 85467194 rs752377530 CTGGA C 4622984
chr16 85467307 rs34646213 G A 4622985
Genes possibly regulated by ZNF143[chr16:85467045-85467327]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr16:85467045-85467327]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results