EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr16:88260180-88260600]
Chromosome characteristics of ZNF143[chr16:88260180-88260600]
Back to top
Enhancers possibly regulated by ZNF143[chr16:88260180-88260600]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 88258045 88283355 enh32027
Prostate (PC-3) Liver (HepG2) Epithelial (MCF-7) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Ovary Lung (PC-9) Bone (Osteoblast) Stomach Colon (HCT116) Brain (SK-N-SH) Muscle (Myoblast) Pancreas Spleen Muscle (Myotube) Uterus Heart
SNP sites on ZNF143[chr16:88260180-88260600]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 88260198 rs13333270 C G 4659609
chr16 88260245 rs538962667 C G 4659610
chr16 88260262 rs556957907 T C 4659611
chr16 88260329 rs565520714 G A 4659612
chr16 88260356 rs148115453 C G 4659613
chr16 88260425 rs563020294 G A 4659614
chr16 88260453 rs530061073 G A 4659615
chr16 88260500 rs112451212 C T 4659616
chr16 88260524 rs573325033 TCCAC T 4659617
chr16 88260546 rs7206407 A G 4659618
chr16 88260552 rs540845475 C CCCTGCGCGTTTCCACCCGTGTCTCCTCCACACCGGGG,CCCTGCGCGTTTCCACCCGTGTCTCCTCCACGCCGGGG 4659619
chr16 88260558 rs552377822 G A,T 4659620
chr16 88260559 rs571451807 C T 4659621
Genes possibly regulated by ZNF143[chr16:88260180-88260600]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr16:88260180-88260600]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results