EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:38674281-38675621]
Chromosome characteristics of ZNF274[chr17:38674281-38675621]
Back to top
Enhancers possibly regulated by ZNF274[chr17:38674281-38675621]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 38663309 38720551 enh17141
Bone Marrow (K562) Brain (SK-N-MC) Liver Astrocyte Colon (HCT116) Adrenal Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Kidney Skin (Keratinocyte) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
chr17 38674878 38675250 vista24726
VISTA
SNP sites on ZNF274[chr17:38674281-38675621]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 38674344 rs143158676 T TG 4867783
chr17 38674458 rs146047664 G T 4867784
chr17 38674525 rs115331575 G A 4867785
chr17 38674554 rs569884205 T A,C 4867786
chr17 38674564 rs552364223 A G 4867787
chr17 38674787 rs80298082 A G 4867788
chr17 38674856 rs141472529 C G 4867789
chr17 38674928 rs73310954 C T 4867790
chr17 38675113 rs146924613 A C 4867791
chr17 38675157 rs645991 C T 4867792
chr17 38675169 rs186931962 A G 4867793
chr17 38675171 rs191509429 G A 4867794
chr17 38675206 rs145478798 T TCC 4867795
chr17 38675209 rs183981226 C T 4867796
chr17 38675265 rs148476629 G GAGGGC 4867797
chr17 38675296 rs78790137 C T 4867798
chr17 38675308 rs189880523 C G 4867799
chr17 38675395 rs147986361 G A 4867800
chr17 38675446 rs374758467 C CCAGCTGCCTCCCCAACTACTTTCCTG 4867801
chr17 38675454 rs181694610 G A 4867802
chr17 38675475 rs552238320 AC A 4867803
chr17 38675570 rs550099957 C T 4867804
chr17 38675609 rs185463915 T C 4867805
Genes possibly regulated by ZNF274[chr17:38674281-38675621]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:38674281-38675621]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results