Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 41528349 rs558603444 G C 4883614
chr17 41528401 rs559266971 C T 4883615
chr17 41528423 rs529938877 G A 4883616
chr17 41528461 rs187591033 C G,T 4883617
chr17 41528469 rs535042378 CAGATTTTTCTGCAGTCCAGA C 4883618
chr17 41528506 rs11656100 A G 4883619
chr17 41528572 rs56810958 G T 4883620
chr17 41528780 rs569735075 A G 4883621

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results