EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:46563949-46564233]
Chromosome characteristics of ZNF274[chr17:46563949-46564233]
Back to top
Enhancers possibly regulated by ZNF274[chr17:46563949-46564233]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 46553725 46585590 enh4456
Bone Marrow (K562) Astrocyte Colon (HCT116) Blood (Karpas-422) Stomach Epithelial (MCF-7) Skin (Keratinocyte) Bone (Osteoblast) Blood (OCI-LY7) Lung (A549) Peripheral Blood (MM.1S) Pancreas (Panc1) Prostate (PC-3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Muscle (Myoblast) Breast Muscle (Myotube) Prostate (RWPE1)
SNP sites on ZNF274[chr17:46563949-46564233]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 46563983 rs142908369 T G 4910009
chr17 46563985 rs11655171 T C 4910010
chr17 46563993 rs570884877 A G 4910011
chr17 46564100 rs112908623 G A 4910012
chr17 46564128 rs572268938 T A,G 4910013
chr17 46564225 rs11271023 G GTTTGGCTTCTACTTTTCTAA 4910014
chr17 46564233 rs115962663 T C 4910015
Genes possibly regulated by ZNF274[chr17:46563949-46564233]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:46563949-46564233]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results