EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:60256193-60256533]
Chromosome characteristics of ZNF274[chr17:60256193-60256533]
Back to top
Enhancers possibly regulated by ZNF274[chr17:60256193-60256533]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 60253851 60272895 enh17275
Bone Marrow (K562) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Stomach Muscle (A673) Placenta Colon (HCT116) Lung (PC-9) Pancreas (Panc1) Neural Stem Cells (H9) Epithelial (MCF-7)
chr17 60255991 60256253 vista25428
VISTA
SNP sites on ZNF274[chr17:60256193-60256533]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 60256208 rs7211390 A G 4972008
chr17 60256228 rs555641285 A G 4972009
chr17 60256384 rs543187751 AACCACATCCTTGCCCCCGCCAAT A 4972010
chr17 60256434 rs187863233 C A 4972011
chr17 60256510 rs78957045 C G 4972012
Genes possibly regulated by ZNF274[chr17:60256193-60256533]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:60256193-60256533]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results