EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:76247856-76248538]
Chromosome characteristics of ZNF274[chr17:76247856-76248538]
Back to top
Enhancers possibly regulated by ZNF274[chr17:76247856-76248538]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 76244565 76276933 enh4623
Bone Marrow (K562) Brain (SK-N-MC) Liver Blood (Karpas-422) Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Bone (Osteoblast) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Muscle (Myotube) Prostate (RWPE1) Muscle (A673) Heart
chr17 76247657 76247919 vista26173
VISTA
chr17 76248336 76248772 vista26174
VISTA
SNP sites on ZNF274[chr17:76247856-76248538]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 76247885 rs544340549 G A,C 5084036
chr17 76248024 rs560068069 G A 5084037
chr17 76248036 rs34219567 A G 5084038
chr17 76248064 rs56245572 G C 5084039
chr17 76248130 rs1109279 T C 5084040
chr17 76248189 rs553940019 GCGCTCAC G 5084041
chr17 76248190 rs532931694 C T 5084042
chr17 76248229 rs1109278 A G 5084043
chr17 76248241 rs141036463 C T 5084044
chr17 76248265 rs79905492 G T 5084045
chr17 76248280 rs12450102 T C 5084046
chr17 76248375 rs566677967 TGAGCCCAGGTGAGGCCCCTAGCCCGAGGCTCC T 5084047
chr17 76248376 rs546406907 G A 5084048
chr17 76248403 rs143349830 G C,T 5084049
chr17 76248408 rs542464005 G A 5084050
Genes possibly regulated by ZNF274[chr17:76247856-76248538]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:76247856-76248538]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results