EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr17:80450158-80450428]
Chromosome characteristics of TCF7L2[chr17:80450158-80450428]
Back to top
Enhancers possibly regulated by TCF7L2[chr17:80450158-80450428]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 80448407 80467804 enh4648
Bone Marrow (K562) Liver Astrocyte Colon (HCT116) Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Skin (Keratinocyte) Brain (SK-N-SH) Bone (Osteoblast) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Prostate (RWPE1) Lung Muscle (A673)
SNP sites on TCF7L2[chr17:80450158-80450428]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 80450186 rs140605131 GGAGTGGTTAAAGTATAAAATA G 5122193
chr17 80450186 rs57902312 GGAGTGGTTAAAGTATAAAATA G 5122194
chr17 80450230 rs144850455 CTTT C 5122195
chr17 80450230 rs542983597 CTTT C 5122196
chr17 80450230 rs754689668 CTTT C 5122197
chr17 80450379 rs59551429 C A,T 5122198
chr17 80450404 rs139489059 G A 5122199
Genes possibly regulated by TCF7L2[chr17:80450158-80450428]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr17:80450158-80450428]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results