Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 80450186 rs140605131 GGAGTGGTTAAAGTATAAAATA G 5122193
chr17 80450186 rs57902312 GGAGTGGTTAAAGTATAAAATA G 5122194
chr17 80450230 rs144850455 CTTT C 5122195
chr17 80450230 rs542983597 CTTT C 5122196
chr17 80450230 rs754689668 CTTT C 5122197
chr17 80450379 rs59551429 C A,T 5122198
chr17 80450404 rs139489059 G A 5122199

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results