EnhancerDB
  1. Home
  2. TFBS
  3. P63[chr18:57623223-57624162]
Chromosome characteristics of P63[chr18:57623223-57624162]
Back to top
Enhancers possibly regulated by P63[chr18:57623223-57624162]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr18 57615485 57630775 enh4882
Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Brain (SK-N-SH) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Blood (OCI-LY7) Lung (A549) Blood (GM12878) Stomach Placenta Colon (HCT116) Blood (Karpas-422) Lung (PC-9) Muscle (Myotube) Epithelial (MCF-7)
SNP sites on P63[chr18:57623223-57624162]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr18 57623285 rs184081810 T A 5297481
chr18 57623460 rs115243451 A T 5297482
chr18 57623462 rs28398963 C G 5297483
chr18 57623494 rs28695747 G A 5297484
chr18 57623569 rs28547071 T C 5297485
chr18 57623620 rs28437193 C T 5297486
chr18 57623714 rs112824240 CA C 5297487
chr18 57623833 rs541056216 C CATATTTTGTTCAGATTTTCTTTTTTTAAATAGTTACA 5297488
chr18 57624002 rs75173691 C T 5297489
Genes possibly regulated by P63[chr18:57623223-57624162]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by P63[chr18:57623223-57624162]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results