Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr18 57623285 rs184081810 T A 5297481
chr18 57623460 rs115243451 A T 5297482
chr18 57623462 rs28398963 C G 5297483
chr18 57623494 rs28695747 G A 5297484
chr18 57623569 rs28547071 T C 5297485
chr18 57623620 rs28437193 C T 5297486
chr18 57623714 rs112824240 CA C 5297487
chr18 57623833 rs541056216 C CATATTTTGTTCAGATTTTCTTTTTTTAAATAGTTACA 5297488

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results