EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr19:1173317-1174063]
Chromosome characteristics of ZNF143[chr19:1173317-1174063]
Back to top
Enhancers possibly regulated by ZNF143[chr19:1173317-1174063]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 1174025 1184042 enh17839
Skin (Keratinocyte) Prostate (PC-3) Large Intestine Esophagus Stomach Placenta Thyroid Lung (PC-9) Pancreas Epithelial (MCF-7)
SNP sites on ZNF143[chr19:1173317-1174063]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 1173554 rs55961439 A G 5372770
chr19 1173824 rs188011428 G A 5372771
chr19 1173826 rs111467467 G T 5372772
chr19 1173827 rs180784229 G A 5372773
chr19 1173840 rs372096825 C T 5372774
chr19 1173866 rs557422584 G A 5372775
chr19 1173893 rs117830785 A G 5372776
chr19 1174016 rs568596329 G GGCGGGGGTCCCGCCGCGCTCGCCCCCGCCCCA 5372777
chr19 1174022 rs555650715 G A 5372778
Genes possibly regulated by ZNF143[chr19:1173317-1174063]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 1107636 1174282 - SBNO2 ENSG00000064932.11 1174282 0.75 1.0 219 16735
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF143[chr19:1173317-1174063]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results