Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 4970368 rs578186270 C G 5405021
chr19 4970458 rs73536536 C T 5405022
chr19 4970465 rs141383674 G C 5405023
chr19 4970474 rs72988139 A G 5405024
chr19 4970593 rs12609484 G T 5405025
chr19 4970723 rs528694087 ACGGGGTCAGCCTTCTCCTGCAGCCCCTGCTGAAG A 5405026
chr19 4970810 rs7255772 C T 5405027
chr19 4970952 rs189893296 C T 5405028
chr19 4971026 rs117921451 G A 5405029
chr19 4971311 rs147183693 C T 5405030
chr19 4971407 rs533273520 T C 5405031
chr19 4971416 rs140410229 T G 5405032
chr19 4971430 rs201042327 TCTC T 5405033
chr19 4971430 rs867382079 TCTC T 5405034
chr19 4971440 rs149680147 T G 5405035
chr19 4971452 rs3835167 C CCT 5405036
chr19 4971561 rs17364488 G A 5405037

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results