EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr19:10727807-10728531]
Chromosome characteristics of ZNF274[chr19:10727807-10728531]
Back to top
Enhancers possibly regulated by ZNF274[chr19:10727807-10728531]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 10720517 10735795 enh17916
Bone Marrow (K562) Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Epithelial (MCF-7) Prostate (RWPE1) Esophagus Astrocyte Bone (Osteoblast) Stomach Placenta Lung (PC-9) Pancreas Muscle (Myotube) Uterus Blood (T-cell) Heart
chr19 10728527 10728590 vista28596
VISTA
SNP sites on ZNF274[chr19:10727807-10728531]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 10727838 rs577663962 C T 5437798
chr19 10727845 rs33959587 CT C 5437799
chr19 10727899 rs375544832 GTTC G 5437800
chr19 10727925 rs73923262 T C 5437801
chr19 10728030 rs8106664 G T 5437802
chr19 10728117 rs369674629 GTGTATGCCAGGCACCTCTCTC G 5437803
chr19 10728154 rs114888011 A G 5437804
chr19 10728167 rs115445672 G A 5437805
chr19 10728285 rs73923264 T C 5437806
chr19 10728320 rs2043305 A G 5437807
chr19 10728330 rs73923265 C T 5437808
chr19 10728415 rs183320093 A C 5437809
chr19 10728438 rs545972528 C T 5437810
chr19 10728491 rs188013027 T C 5437811
Genes possibly regulated by ZNF274[chr19:10727807-10728531]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr19:10727807-10728531]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results