EnhancerDB
  1. Home
  2. TFBS
  3. FOXB1[chr15:41545620-41545631]
Chromosome characteristics of FOXB1[chr15:41545620-41545631]
Back to top
Enhancers possibly regulated by FOXB1[chr15:41545620-41545631]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 41539463 41554335 enh3544
Skin (Keratinocyte) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Lung (PC-9) Astrocyte Lung Blood (OCI-LY7) Stomach Colon (HCT116) Thyroid Blood (Karpas-422) Muscle (Myoblast) Pancreas Heart
SNP sites on FOXB1[chr15:41545620-41545631]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 41545621 rs373688528 G GCATT,GTATT,GTATTTATTTATT,GTTTTATT 3916905
chr15 41545621 rs527841412 GTATTTATTTATTTATTTATTTATT G 3916906
chr15 41545624 rs202140339 T TTTAC 3916907
Genes possibly regulated by FOXB1[chr15:41545620-41545631]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by FOXB1[chr15:41545620-41545631]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results