EnhancerDB
  1. Home
  2. TFBS
  3. JUN[chr1:19253814-19253821]
Chromosome characteristics of JUN[chr1:19253814-19253821]
Back to top
Enhancers possibly regulated by JUN[chr1:19253814-19253821]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 19252691 19280920 enh11566
Brain (SK-N-MC) Astrocyte Colon (HCT116) Adrenal Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Kidney Stomach Bone (Osteoblast) Thyroid Peripheral Blood (MM.1S) Neural Stem Cells (H9) Thymus Prostate (PC-3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on JUN[chr1:19253814-19253821]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 19253815 rs372402986 TGAGCTCAGGTGAGGCTGGGCTGGA T 128103
chr1 19253815 rs373258654 TGAGCTCAGGTGAGGCTGGGCTGGA T 128104
chr1 19253817 rs9426701 A C 128105
chr1 19253818 rs566186720 G C 128106
Genes possibly regulated by JUN[chr1:19253814-19253821]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by JUN[chr1:19253814-19253821]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results