Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 19801145 19810806 enh11569
chr1 19804974 19805167 vista620

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 19805161 rs540516494 T TTGGACATACTTGCTTCCACC 132364

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results