| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr1 | 27058625 | 27079175 | enh167 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr1 | 27064255 | rs375832052 | CTGAGGCAGGAGAATCGCTTGAACCTGGGAGGCAGAGGTTGCGG | C | 181935 | |
| chr1 | 27064255 | rs562007611 | CTGAGGCAGGAGAATCGCTTGAACCTGGGAGGCAGAGGTTGCGG | C | 181936 | |
| chr1 | 27064260 | rs185143150 | G | C | 181937 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|