Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 53487285 53493435 enh11855

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 53492239 rs377373908 G GGAGGCCAATGTGGGAGGATCGATT 311843
chr1 53492239 rs567496392 G GGAGGCCAATGTGGGAGGATCGATT 311844

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results