EnhancerDB
  1. Home
  2. TFBS
  3. MAFF[chr1:53492221-53492239]
Chromosome characteristics of MAFF[chr1:53492221-53492239]
Back to top
Enhancers possibly regulated by MAFF[chr1:53492221-53492239]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 53487285 53493435 enh11855
Liver (HepG2) Cervix (HeLa-S3) Large Intestine Esophagus Astrocyte Bone (Osteoblast) Stomach Placenta Adrenal Uterus Spleen Neural Stem Cells (H9) Heart
SNP sites on MAFF[chr1:53492221-53492239]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 53492239 rs377373908 G GGAGGCCAATGTGGGAGGATCGATT 311843
chr1 53492239 rs567496392 G GGAGGCCAATGTGGGAGGATCGATT 311844
Genes possibly regulated by MAFF[chr1:53492221-53492239]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by MAFF[chr1:53492221-53492239]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results