EnhancerDB
  1. Home
  2. TFBS
  3. MAFK[chr3:8543114-8543129]
Chromosome characteristics of MAFK[chr3:8543114-8543129]
Back to top
Enhancers possibly regulated by MAFK[chr3:8543114-8543129]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 8538945 8574055 enh35162
Brain (SK-N-MC) Astrocyte Colon (HCT116) Pancreas Uterus Stomach Brain (SK-N-SH) Ovary Blood (OCI-LY7) Pancreas (Panc1) Neural Stem Cells (H9) Prostate (PC-3) Large Intestine Esophagus Lung (PC-9) Muscle (Myoblast) Spleen Liver (HepG2) Lung Muscle (A673) Heart
SNP sites on MAFK[chr3:8543114-8543129]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 8543115 rs564255199 A ACAGCTCAGCATTTATTTCTGGATC 6534132
Genes possibly regulated by MAFK[chr3:8543114-8543129]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr3 8543393 8609805 + LMCD1 ENSG00000071282.7 8543393 0.87 0.97 264 3372
Expression level of Genes
Back to top
miRNAs possibly regulated by MAFK[chr3:8543114-8543129]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results