Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 8543115 rs564255199 A ACAGCTCAGCATTTATTTCTGGATC 6534132

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr3 8543393 8609805 + LMCD1 ENSG00000071282.7 8543393 0.87 0.97 264 3372


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results