EnhancerDB
  1. Home
  2. TFBS
  3. E2F8[chr1:151955272-151955284]
Chromosome characteristics of E2F8[chr1:151955272-151955284]
Back to top
Enhancers possibly regulated by E2F8[chr1:151955272-151955284]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 151932405 151955339 enh12260
Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Epithelial (MCF-7) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Stomach Placenta Colon (HCT116) Thyroid Lung (PC-9) Kidney Muscle (Myotube) Neural Stem Cells (H9) Heart
SNP sites on E2F8[chr1:151955272-151955284]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 151955279 rs11273342 G GAGAAAAGCTCTGCTGTGTA 628458
chr1 151955279 rs113674295 G GAGAAAAGCTCTGCTGTGTA 628459
Genes possibly regulated by E2F8[chr1:151955272-151955284]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by E2F8[chr1:151955272-151955284]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results