Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 178908836 rs151151560 TGATGGGGGATTTTCCCCCTGGG T 757351
chr1 178908838 rs7538382 A G 757352

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results