Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 230129945 230140438 enh64203

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 230135495 rs193077399 C A,T 1013946
chr1 230135496 rs11122550 G A 1013947
chr1 230135511 rs572999923 C CAGGTCTCCTTTTTAAATCTAACTA 1013948

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results