Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 231540925 231559675 enh985

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 231558102 rs541010349 AGGGAGGGCCGGGAGGGCCGGG A 1023065

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 231499497 231560790 - EGLN1 ENSG00000135766.8 231560790 0.6 1.0 2669 1951


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results