Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 5614957 5623881 enh58320

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 5617633 rs536838976 AAGCTGAAGTATGTAGAGGAG A 1818331

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr11 5617339 5634188 + TRIM6 ENSG00000121236.15 5617339 0.91 0.96 290 10487
chr11 5617955 5665628 + TRIM6-TRIM34 ENSG00000258588.2 5617955 0.77 0.96 312 10488


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results