| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr11 | 8845499 | 8859455 | enh13735 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr11 | 8858779 | rs144972871 | GTAAGTGTATTTGGGGAGGAGGGATGGGGATTACA | G | 1830930 | |
| chr11 | 8858779 | rs375555816 | GTAAGTGTATTTGGGGAGGAGGGATGGGGATTACA | G | 1830931 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|