EnhancerDB
  1. Home
  2. TFBS
  3. STAT1[chr11:13349426-13349441]
Chromosome characteristics of STAT1[chr11:13349426-13349441]
Back to top
Enhancers possibly regulated by STAT1[chr11:13349426-13349441]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 13349249 13368067 enh28612
Liver Astrocyte Colon (HCT116) Pancreas Uterus Blood (T-cell) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Pancreas (Panc1) Prostate (PC-3) Cervix (HeLa-S3) Esophagus Blood (GM12878) Lung (PC-9) Muscle (Myoblast) Spleen Muscle (Myotube) Prostate (RWPE1) Lung Muscle (A673)
SNP sites on STAT1[chr11:13349426-13349441]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 13349440 rs60523221 T TCCACCCAGGGATCCCAGTTAACAATTTC 1864770
Genes possibly regulated by STAT1[chr11:13349426-13349441]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by STAT1[chr11:13349426-13349441]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results