EnhancerDB
  1. Home
  2. TFBS
  3. MSC[chr11:19974969-19974979]
Chromosome characteristics of MSC[chr11:19974969-19974979]
Back to top
Enhancers possibly regulated by MSC[chr11:19974969-19974979]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 19970665 19987395 enh13835
Astrocyte Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Epithelial (MCF-7) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Peripheral Blood (MM.1S) Neural Stem Cells (H9) Prostate (PC-3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Liver (HepG2) Prostate (RWPE1) Heart
SNP sites on MSC[chr11:19974969-19974979]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 19974974 rs545874450 GCTGGTTCCTGCATTTGCAAAGCCCTGCCT G 1893285
chr11 19974978 rs537733274 G A 1893286
Genes possibly regulated by MSC[chr11:19974969-19974979]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by MSC[chr11:19974969-19974979]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results