| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr11 | 19970665 | 19987395 | enh13835 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr11 | 19976473 | rs12796068 | A | G | 1893317 | |
| chr11 | 19976475 | rs57837920 | A | G | 1893318 | |
| chr11 | 19976482 | rs368562515 | TATATATACATATATACATATATATATACATATACACAC | T | 1893319 | |
| chr11 | 19976482 | rs59756904 | TATATATACATATATACATATATATATACATATACACAC | T | 1893320 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|