EnhancerDB
  1. Home
  2. TFBS
  3. USF1[chr11:62311882-62311893]
Chromosome characteristics of USF1[chr11:62311882-62311893]
Back to top
Enhancers possibly regulated by USF1[chr11:62311882-62311893]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 62301390 62312935 enh13975
Bone Marrow (K562) Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Brain (SK-N-SH) Blood (T-cell) Lung (PC-9) Astrocyte Bone (Osteoblast) Blood (GM12878) Stomach Muscle (A673) Placenta Peripheral Blood (MM.1S) Muscle (Myoblast) Pancreas Muscle (Myotube) Uterus Thymus Heart
SNP sites on USF1[chr11:62311882-62311893]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 62311886 rs528991986 A T 2032273
chr11 62311887 rs138773174 TGTGTCCCTGTTCTCTGACCA T 2032274
chr11 62311887 rs369345906 TGTGTCCCTGTTCTCTGACCA T 2032275
Genes possibly regulated by USF1[chr11:62311882-62311893]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by USF1[chr11:62311882-62311893]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results