EnhancerDB
  1. Home
  2. TFBS
  3. VAX1[chr8:12986408-12986416]
Chromosome characteristics of VAX1[chr8:12986408-12986416]
Back to top
Enhancers possibly regulated by VAX1[chr8:12986408-12986416]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr8 12974585 12989921 enh24752
Liver (HepG2) Brain (SK-N-MC) Esophagus Bone (Osteoblast) Lung Stomach Muscle (A673) Placenta Thyroid Uterus Peripheral Blood (MM.1S) Muscle (Myoblast) Muscle (Myotube) Neural Stem Cells (H9) Heart
SNP sites on VAX1[chr8:12986408-12986416]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr8 12986410 rs544891417 T TAATTATGATGGCAAGGCAGAACA 10294927
chr8 12986410 rs71207124 T TAATTATGATGGCAAGGCAGAACA 10294928
chr8 12986410 rs746384501 T TAATTATGATGGCAAGGCAGAACA 10294929
chr8 12986410 rs770299256 T TAATTATGATGGCAAGGCAGAACA 10294930
chr8 12986410 rs780610195 T TAATTATGATGGCAAGGCAGAACA 10294931
Genes possibly regulated by VAX1[chr8:12986408-12986416]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by VAX1[chr8:12986408-12986416]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results