Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr8 125629255 rs537936077 ACATAAGTGGTAAACCAACAGATGGAAATGCTGTC A 10739464
chr8 125629255 rs59637518 ACATAAGTGGTAAACCAACAGATGGAAATGCTGTC A 10739465

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results