Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
---|---|---|---|---|---|
chr8 | 125602445 | 125658555 | enh10511 |
|
Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
---|---|---|---|---|---|---|
chr8 | 125629255 | rs537936077 | ACATAAGTGGTAAACCAACAGATGGAAATGCTGTC | A | 10739464 | |
chr8 | 125629255 | rs59637518 | ACATAAGTGGTAAACCAACAGATGGAAATGCTGTC | A | 10739465 |
Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|
Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|