Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 27262265 27268135 enh31750
chr16 27263252 27263592 vista22260

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 27263277 rs574523487 TCCTCAACGCAGGGAGGCTG T 4394588

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results