Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85446773 85473775 enh16869
chr16 85458916 85459273 vista23306

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85458906 rs144839284 C CACGGGTGATGTGAGGTGGTG 4622791
chr16 85458913 rs56850784 G A 4622792

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results