Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 1909076 rs147257006 CTTTTATTTTTCTTTCTTCCTTTTTTT C 4698264
chr17 1909076 rs755157071 CTTTTATTTTTCTTTCTTCCTTTTTTT C 4698265

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results