| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr17 | 1888491 | 1923135 | enh16929 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr17 | 1909076 | rs147257006 | CTTTTATTTTTCTTTCTTCCTTTTTTT | C | 4698264 | |
| chr17 | 1909076 | rs755157071 | CTTTTATTTTTCTTTCTTCCTTTTTTT | C | 4698265 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|