Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 37031409 rs567601337 GAGGCAGGGGCCCAGGCAGGGGCCT G 4858543

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 37071270 37071290 + hsa-miR-6779-3p MIMAT0027459 37026310 0.0 0.0 5091 699