EnhancerDB
  1. Home
  2. TFBS
  3. SP1[chr17:37031407-37031417]
Chromosome characteristics of SP1[chr17:37031407-37031417]
Back to top
Enhancers possibly regulated by SP1[chr17:37031407-37031417]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 37029985 37052775 enh4386
Bone Marrow (K562) Astrocyte Blood (Karpas-422) Embryonic Stem Cell Line (H1-hESC) Uterus Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Lung (A549) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Blood (GM12878) Placenta Muscle (Myoblast) Liver (HepG2) Muscle (A673) Heart
SNP sites on SP1[chr17:37031407-37031417]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 37031409 rs567601337 GAGGCAGGGGCCCAGGCAGGGGCCT G 4858543
Genes possibly regulated by SP1[chr17:37031407-37031417]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by SP1[chr17:37031407-37031417]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 37071270 37071290 + hsa-miR-6779-3p MIMAT0027459 37026310 0.0 0.0 5097 699
Expression level of miRNAs
Back to top