Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 37043563 rs572921748 AGGAGGGTCGTCTCGTCTCT A 4858697
chr17 37043567 rs541890531 G C 4858698

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results