Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 63097005 63106030 enh58772

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 63099704 rs448597 G A 4988232
chr17 63099707 rs569236296 TACCAGCCAAGCTGATGCCA T 4988233

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results