EnhancerDB
  1. Home
  2. TFBS
  3. FOXP1[chr17:71290489-71290504]
Chromosome characteristics of FOXP1[chr17:71290489-71290504]
Back to top
Enhancers possibly regulated by FOXP1[chr17:71290489-71290504]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 71282705 71302156 enh17360
Bone Marrow (K562) Brain (SK-N-MC) Liver Astrocyte Colon (HCT116) Pancreas Uterus Stomach Skin (Keratinocyte) Brain (SK-N-SH) Bone (Osteoblast) Thyroid Peripheral Blood (MM.1S) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Liver (HepG2) Prostate (RWPE1) Muscle (A673) Heart
SNP sites on FOXP1[chr17:71290489-71290504]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 71290490 rs11077677 CA C 5042561
chr17 71290490 rs368124128 CAAAAAAAAACAAACAAAGAAA C 5042562
chr17 71290490 rs398031538 CA C 5042563
chr17 71290490 rs398079160 CA C 5042564
Genes possibly regulated by FOXP1[chr17:71290489-71290504]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by FOXP1[chr17:71290489-71290504]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results