EnhancerDB
  1. Home
  2. TFBS
  3. HOXA5[chr17:75141155-75141163]
Chromosome characteristics of HOXA5[chr17:75141155-75141163]
Back to top
Enhancers possibly regulated by HOXA5[chr17:75141155-75141163]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 75138424 75164095 enh4613
Liver (HepG2) Brain (SK-N-SH) Liver Astrocyte Blood (OCI-LY7) Blood (GM12878) Stomach Placenta Thyroid Uterus Peripheral Blood (MM.1S) Blood (Karpas-422) Muscle (Myoblast) Pancreas Adrenal Neural Stem Cells (H9) Heart
SNP sites on HOXA5[chr17:75141155-75141163]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 75141159 rs560715925 TTGTGTGTGTGTGTGTGTATGTA T 5070429
chr17 75141159 rs56235460 TTGTGTGTGTGTGTGTGTATGTA T 5070430
chr17 75141159 rs756851337 TTGTGTGTGTGTGTGTGTATGTA T 5070431
Genes possibly regulated by HOXA5[chr17:75141155-75141163]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by HOXA5[chr17:75141155-75141163]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results