EnhancerDB
  1. Home
  2. TFBS
  3. H4TF2[chr17:75418742-75418746]
Chromosome characteristics of H4TF2[chr17:75418742-75418746]
Back to top
Enhancers possibly regulated by H4TF2[chr17:75418742-75418746]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 75373666 75445575 enh4617
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Adrenal Blood (Karpas-422) Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Breast Muscle (Myoblast) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on H4TF2[chr17:75418742-75418746]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 75418745 rs146993052 TCCATCCCCATGAAACCGGGC T 5074607
chr17 75418745 rs374446856 TCCATCCCCATGAAACCGGGC T 5074608
Genes possibly regulated by H4TF2[chr17:75418742-75418746]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by H4TF2[chr17:75418742-75418746]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results