EnhancerDB
  1. Home
  2. TFBS
  3. JUND[chr13:114616720-114616731]
Chromosome characteristics of JUND[chr13:114616720-114616731]
Back to top
Enhancers possibly regulated by JUND[chr13:114616720-114616731]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr13 114596905 114623122 enh30713
Skin (Keratinocyte) Prostate (PC-3) Brain (SK-N-SH) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Bone (Osteoblast) Colon (HCT116) Thyroid Peripheral Blood (MM.1S) Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Uterus Stomach
SNP sites on JUND[chr13:114616720-114616731]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr13 114616722 rs71101600 G GA,GTGATTCACACGTGAGCCAACAGTGAAGGAGGCATTGATCGGGAGA 3413912
Genes possibly regulated by JUND[chr13:114616720-114616731]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by JUND[chr13:114616720-114616731]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results