Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 78784945 78794495 enh59503

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 78790451 rs550871160 GGAGGCCAAGGCGGGTGGAACACTT G 8332385

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results