Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 149243665 149256515 enh63216

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 149251589 rs138842950 CTATAAAGATTAGAAAGCGTACT C 7102336
chr3 149251589 rs377737532 CTATAAAGATTAGAAAGCGTACT C 7102337
chr3 149251591 rs568620167 A G 7102338

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results