EnhancerDB
  1. Home
  2. TFBS
  3. ZNF263[chr5:148369372-148369393]
Chromosome characteristics of ZNF263[chr5:148369372-148369393]
Back to top
Enhancers possibly regulated by ZNF263[chr5:148369372-148369393]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 148334219 148384969 enh22691
Skin (Keratinocyte) Prostate (PC-3) Kidney Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Lung (PC-9) Bone (Osteoblast) Lung Stomach Placenta Colon (HCT116) Breast Muscle (Myoblast) Pancreas Pancreas (Panc1) Neural Stem Cells (H9) Heart
SNP sites on ZNF263[chr5:148369372-148369393]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 148369380 rs17109192 C T 8604623
chr5 148369385 rs552962885 AGAGAAGAACTATATAGCAACCAG A 8604624
Genes possibly regulated by ZNF263[chr5:148369372-148369393]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF263[chr5:148369372-148369393]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results