Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 149959646 149975497 enh22719

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 149963638 rs149247900 GACAGCCCAGCTTCCTACCA G 8615871

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results