Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 170944370 170953795 enh22797

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 170950160 rs200137656 TCATC T 8694844
chr5 170950160 rs542605961 TCATCCATCCATCCATCCATC T 8694845
chr5 170950160 rs561440845 T TCATC 8694846
chr5 170950160 rs750072956 T TCATC 8694847

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results